29
Nov
2009
admin

PIR DNA


>DL; Cow
Cow
ATGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTACTTCACTTTCATGAC
CACACGCTAATAATTGTCTTCTTAATTAGCTCATTAGTACTTTACATTATTTCACTAATACTAACGACAAAGCTG
ACCCATACAAGCACGATAGATGCACAAGAAGTAGAGACAATCTGAACCATTCTGCCCGCCATCATCTTAATTCTA
ATTGCTCTTCCTTCTTTACGAATTCTATACATAATAGATGAAATCAATAACCCATCTCTTACAGTAAAAACCATA
GGACATCAGTGATACTGAAGCTATGAGTATACAGATTATGAGGACTTAAGCTTCGACTCCTACATAATTCCAACA
TCAGAATTAAAGCCAGGGGAGCTACGACTATTAGAAGTCGATAATCGAGTTGTACTACCAATAGAAATAACAATC
CGAATGTTAGTCTCCTCTGAAGACGTATTACACTCATGAGCTGTGCCCTCTCTAGGACTAAAAACAGACGCAATC
CCAGGCCGTCTAAACCAAACAACCCTTATATCGTCCCGTCCAGGCTTATATTACGGTCAATGCTCAGAAATTTGC
GGGTCAAACCACAGTTTCATACCCATTGTCCTTGAGTTAGTCCCACTAAAGTACTTTGAAAAATGATCTGCGTCA
ATATTA---------------------TAA*
>DL; Carp
Carp
ATGGCACACCCAACGCAACTAGGTTTCAAGGACGCGGCCATACCCGTTATAGAGGAACTTCTTCACTTCCACGAC
CACGCATTAATAATTGTGCTCCTAATTAGCACTTTAGTTTTATATATTATTACTGCAATGGTATCAACTAAACTT
ACTAATAAATATATTCTAGACTCCCAAGAAATCGAAATCGTATGAACCATTCTACCAGCCGTCATTTTAGTACTA
ATCGCCCTGCCCTCCCTACGCATCCTGTACCTTATAGACGAAATTAACGACCCTCACCTGACAATTAAAGCAATA
GGACACCAATGATACTGAAGTTACGAGTATACAGACTATGAAAATCTAGGATTCGACTCCTATATAGTACCAACC
CAAGACCTTGCCCCCGGACAATTCCGACTTCTGGAAACAGACCACCGAATAGTTGTTCCAATAGAATCCCCAGTC
CGTGTCCTAGTATCTGCTGAAGACGTGCTACATTCTTGAGCTGTTCCATCCCTTGGCGTAAAAATGGACGCAGTC
CCAGGACGACTAAATCAAGCCGCCTTTATTGCCTCACGCCCAGGGGTCTTTTACGGACAATGCTCTGAAATTTGT
GGAGCTAATCACAGCTTTATACCAATTGTAGTTGAAGCAGTACCTCTCGAACACTTCGAAAACTGATCCTCATTA
ATACTAGAAGACGCCTCGCTAGGAAGCTAA*
>DL; Chicken
Chicken
ATGGCCAACCACTCCCAACTAGGCTTTCAAGACGCCTCATCCCCCATCATAGAAGAGCTCGTTGAATTCCACGAC
CACGCCCTGATAGTCGCACTAGCAATTTGCAGCTTAGTACTCTACCTTCTAACTCTTATACTTATAGAAAAACTA
TCA---TCAAACACCGTAGATGCCCAAGAAGTTGAACTAATCTGAACCATCCTACCCGCTATTGTCCTAGTCCTG
CTTGCCCTCCCCTCCCTCCAAATCCTCTACATAATAGACGAAATCGACGAACCTGATCTCACCCTAAAAGCCATC
GGACACCAATGATACTGAACCTATGAATACACAGACTTCAAGGACCTCTCATTTGACTCCTACATAACCCCAACA
ACAGACCTCCCCCTAGGCCACTTCCGCCTACTAGAAGTCGACCATCGCATTGTAATCCCCATAGAATCCCCCATT
CGAGTAATCATCACCGCTGATGACGTCCTCCACTCATGAGCCGTACCCGCCCTCGGGGTAAAAACAGACGCAATC
CCTGGACGACTAAATCAAACCTCCTTCATCACCACTCGACCAGGAGTGTTTTACGGACAATGCTCAGAAATCTGC
GGAGCTAACCACAGCTACATACCCATTGTAGTAGAGTCTACCCCCCTAAAACACTTTGAAGCCTGATCCTCACTA
------------------CTGTCATCTTAA*
>DL; Human
Human
ATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGAT
CACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAAAACTA
ACTAATACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCTAGTCCTC
ATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATCAATT
GGCCACCAATGGTACTGAACCTACGAGTACACCGACTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCA
TTATTCCTAGAACCAGGCGACCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCCCCATT
CGTATAATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAAACAGATGCAATT
CCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGACCGGGGGTATACTACGGTCAATGCTCTGAAATCTGT
GGAGCAAACCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCCTAAAAATCTTTGAAATA------------
---------GGGCCCGTATTTACCCTATAG*
>DL; Loach
Loach
ATGGCACATCCCACACAATTAGGATTCCAAGACGCGGCCTCACCCGTAATAGAAGAACTTCTTCACTTCCATGAC
CATGCCCTAATAATTGTATTTTTGATTAGCGCCCTAGTACTTTATGTTATTATTACAACCGTCTCAACAAAACTC
ACTAACATATATATTTTGGACTCACAAGAAATTGAAATCGTATGAACTGTGCTCCCTGCCCTAATCCTCATTTTA
ATCGCCCTCCCCTCACTACGAATTCTATATCTTATAGACGAGATTAATGACCCCCACCTAACAATTAAGGCCATG
GGGCACCAATGATACTGAAGCTACGAGTATACTGATTATGAAAACTTAAGTTTTGACTCCTACATAATCCCCACC
CAGGACCTAACCCCTGGACAATTCCGGCTACTAGAGACAGACCACCGAATGGTTGTTCCCATAGAATCCCCTATT
CGCATTCTTGTTTCCGCCGAAGATGTACTACACTCCTGGGCCCTTCCAGCCATGGGGGTAAAGATAGACGCGGTC
CCAGGACGCCTTAACCAAACCGCCTTTATTGCCTCCCGCCCCGGGGTATTCTATGGGCAATGCTCAGAAATCTGT
GGAGCAAACCACAGCTTTATACCCATCGTAGTAGAAGCGGTCCCACTATCTCACTTCGAAAACTGGTCCACCCTT
ATACTAAAAGACGCCTCACTAGGAAGCTAA*
>DL; Mouse
Mouse
ATGGCCTACCCATTCCAACTTGGTCTACAAGACGCCACATCCCCTATTATAGAAGAGCTAATAAATTTCCATGAT
CACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTAACAACAAAACTA
ACACATACAAGCACAATAGATGCACAAGAAGTTGAAACCATTTGAACTATTCTACCAGCTGTAATCCTTATCATA
ATTGCTCTCCCCTCTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATA
GGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCATATATAATCCCAACA
AACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGTTCTGCCAATAGAACTTCCAATC
CGTATATTAATTTCATCTGAAGACGTCCTCCACTCATGAGCAGTCCCCTCCCTAGGACTTAAAACTGATGCCATC
CCAGGCCGACTAAATCAAGCAACAGTAACATCAAACCGACCAGGGTTATTCTATGGCCAATGCTCTGAAATTTGT
GGATCTAACCATAGCTTTATGCCCATTGTCCTAGAAATGGTTCCACTAAAATATTTCGAAAACTGATCTGCTTCA
ATAATT---------------------TAA*
>DL; Rat
Rat
ATGGCTTACCCATTTCAACTTGGCTTACAAGACGCTACATCACCTATCATAGAAGAACTTACAAACTTTCATGAC
CACACCCTAATAATTGTATTCCTCATCAGCTCCCTAGTACTTTATATTATTTCACTAATACTAACAACAAAACTA
ACACACACAAGCACAATAGACGCCCAAGAAGTAGAAACAATTTGAACAATTCTCCCAGCTGTCATTCTTATTCTA
ATTGCCCTTCCCTCCCTACGAATTCTATACATAATAGACGAGATTAATAACCCAGTTCTAACAGTAAAAACTATA
GGACACCAATGATACTGAAGCTATGAATATACTGACTATGAAGACCTATGCTTTGACTCCTACATAATCCCAACC
AATGACCTAAAACCAGGTGAACTTCGTCTATTAGAAGTTGATAATCGGGTAGTCTTACCAATAGAACTTCCAATT
CGTATACTAATCTCATCCGAAGACGTCCTGCACTCATGAGCCATCCCTTCACTAGGGTTAAAAACCGACGCAATC
CCCGGCCGCCTAAACCAAGCTACAGTCACATCAAACCGACCAGGTCTATTCTATGGCCAATGCTCTGAAATTTGC
GGCTCAAATCACAGCTTCATACCCATTGTACTAGAAATAGTGCCTCTAAAATATTTCGAAAACTGATCAGCTTCT
ATAATT---------------------TAA*
>DL; Seal
Seal
ATGGCATACCCCCTACAAATAGGCCTACAAGATGCAACCTCTCCCATTATAGAGGAGTTACTACACTTCCATGAC
CACACATTAATAATTGTGTTCCTAATTAGCTCATTAGTACTCTACATTATCTCACTTATACTAACCACGAAACTC
ACCCACACAAGTACAATAGACGCACAAGAAGTGGAAACGGTGTGAACGATCCTACCCGCTATCATTTTAATTCTC
ATTGCCCTACCATCATTACGAATCCTCTACATAATGGACGAGATCAATAACCCTTCCTTGACCGTAAAAACTATA
GGACATCAGTGATACTGAAGCTATGAGTACACAGACTACGAAGACCTGAACTTTGACTCATATATGATCCCCACA
CAAGAACTAAAGCCCGGAGAACTACGACTGCTAGAAGTAGACAATCGAGTAGTCCTCCCAATAGAAATAACAATC
CGCATACTAATCTCATCAGAAGATGTACTCCACTCATGAGCCGTACCGTCCCTAGGACTAAAAACTGATGCTATC
CCAGGACGACTAAACCAAACAACCCTAATAACCATACGACCAGGACTGTACTACGGTCAATGCTCAGAAATCTGT
GGTTCAAACCACAGCTTCATACCTATTGTCCTCGAATTGGTCCCACTATCCCACTTCGAGAAATGATCTACCTCA
ATGCTT---------------------TAA*
>DL; Whale
Whale
ATGGCATATCCATTCCAACTAGGTTTCCAAGATGCAGCATCACCCATCATAGAAGAGCTCCTACACTTTCACGAT
CATACACTAATAATCGTTTTTCTAATTAGCTCTTTAGTTCTCTACATTATTACCCTAATGCTTACAACCAAATTA
ACACATACTAGTACAATAGACGCCCAAGAAGTAGAAACTGTCTGAACTATCCTCCCAGCCATTATCTTAATTTTA
ATTGCCTTGCCTTCATTACGGATCCTTTACATAATAGACGAAGTCAATAACCCCTCCCTCACTGTAAAAACAATA
GGTCACCAATGATATTGAAGCTATGAGTATACCGACTACGAAGACCTAAGCTTCGACTCCTATATAATCCCAACA
TCAGACCTAAAGCCAGGAGAACTACGATTATTAGAAGTAGATAACCGAGTTGTCTTACCTATAGAAATAACAATC
CGAATATTAGTCTCATCAGAAGACGTACTCCACTCATGGGCCGTACCCTCCTTGGGCCTAAAAACAGATGCAATC
CCAGGACGCCTAAACCAAACAACCTTAATATCAACACGACCAGGCCTATTTTATGGACAATGCTCAGAGATCTGC
GGCTCAAACCACAGTTTCATACCAATTGTCCTAGAACTAGTACCCCTAGAAGTCTTTGAAAAATGATCTGTATCA
ATACTA---------------------TAA*
>DL; Frog
Frog
ATGGCACACCCATCACAATTAGGTTTTCAAGACGCAGCCTCTCCAATTATAGAAGAATTACTTCACTTCCACGAC
CATACCCTCATAGCCGTTTTTCTTATTAGTACGCTAGTTCTTTACATTATTACTATTATAATAACTACTAAACTA
ACTAATACAAACCTAATGGACGCACAAGAGATCGAAATAGTGTGAACTATTATACCAGCTATTAGCCTCATCATA
ATTGCCCTTCCATCCCTTCGTATCCTATATTTAATAGATGAAGTTAATGATCCACACTTAACAATTAAAGCAATC
GGCCACCAATGATACTGAAGCTACGAATATACTAACTATGAGGATCTCTCATTTGACTCTTATATAATTCCAACT
AATGACCTTACCCCTGGACAATTCCGGCTGCTAGAAGTTGATAATCGAATAGTAGTCCCAATAGAATCTCCAACC
CGACTTTTAGTTACAGCCGAAGACGTCCTCCACTCGTGAGCTGTACCCTCCTTGGGTGTCAAAACAGATGCAATC
CCAGGACGACTTCATCAAACATCATTTATTGCTACTCGTCCGGGAGTATTTTACGGACAATGTTCAGAAATTTGC
GGAGCAAACCACAGCTTTATACCAATTGTAGTTGAAGCAGTACCGCTAACCGACTTTGAAAACTGATCTTCATCA
ATACTA---GAAGCATCACTA------AGA*