29
Nov
2009
admin

PHYLIP DNA


10 705
Cow       ATGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTA
Carp      ATGGCACACCCAACGCAACTAGGTTTCAAGGACGCGGCCATACCCGTTATAGAGGAACTT
Chicken   ATGGCCAACCACTCCCAACTAGGCTTTCAAGACGCCTCATCCCCCATCATAGAAGAGCTC
Human     ATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTT
Loach     ATGGCACATCCCACACAATTAGGATTCCAAGACGCGGCCTCACCCGTAATAGAAGAACTT
Mouse     ATGGCCTACCCATTCCAACTTGGTCTACAAGACGCCACATCCCCTATTATAGAAGAGCTA
Rat       ATGGCTTACCCATTTCAACTTGGCTTACAAGACGCTACATCACCTATCATAGAAGAACTT
Seal      ATGGCATACCCCCTACAAATAGGCCTACAAGATGCAACCTCTCCCATTATAGAGGAGTTA
Whale     ATGGCATATCCATTCCAACTAGGTTTCCAAGATGCAGCATCACCCATCATAGAAGAGCTC
Frog      ATGGCACACCCATCACAATTAGGTTTTCAAGACGCAGCCTCTCCAATTATAGAAGAATTA

CTTCACTTTCATGACCACACGCTAATAATTGTCTTCTTAATTAGCTCATTAGTACTTTAC
CTTCACTTCCACGACCACGCATTAATAATTGTGCTCCTAATTAGCACTTTAGTTTTATAT
GTTGAATTCCACGACCACGCCCTGATAGTCGCACTAGCAATTTGCAGCTTAGTACTCTAC
ATCACCTTTCATGATCACGCCCTCATAATCATTTTCCTTATCTGCTTCCTAGTCCTGTAT
CTTCACTTCCATGACCATGCCCTAATAATTGTATTTTTGATTAGCGCCCTAGTACTTTAT
ATAAATTTCCATGATCACACACTAATAATTGTTTTCCTAATTAGCTCCTTAGTCCTCTAT
ACAAACTTTCATGACCACACCCTAATAATTGTATTCCTCATCAGCTCCCTAGTACTTTAT
CTACACTTCCATGACCACACATTAATAATTGTGTTCCTAATTAGCTCATTAGTACTCTAC
CTACACTTTCACGATCATACACTAATAATCGTTTTTCTAATTAGCTCTTTAGTTCTCTAC
CTTCACTTCCACGACCATACCCTCATAGCCGTTTTTCTTATTAGTACGCTAGTTCTTTAC

ATTATTTCACTAATACTAACGACAAAGCTGACCCATACAAGCACGATAGATGCACAAGAA
ATTATTACTGCAATGGTATCAACTAAACTTACTAATAAATATATTCTAGACTCCCAAGAA
CTTCTAACTCTTATACTTATAGAAAAACTATCA---TCAAACACCGTAGATGCCCAAGAA
GCCCTTTTCCTAACACTCACAACAAAACTAACTAATACTAACATCTCAGACGCTCAGGAA
GTTATTATTACAACCGTCTCAACAAAACTCACTAACATATATATTTTGGACTCACAAGAA
ATCATCTCGCTAATATTAACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAA
ATTATTTCACTAATACTAACAACAAAACTAACACACACAAGCACAATAGACGCCCAAGAA
ATTATCTCACTTATACTAACCACGAAACTCACCCACACAAGTACAATAGACGCACAAGAA
ATTATTACCCTAATGCTTACAACCAAATTAACACATACTAGTACAATAGACGCCCAAGAA
ATTATTACTATTATAATAACTACTAAACTAACTAATACAAACCTAATGGACGCACAAGAG

GTAGAGACAATCTGAACCATTCTGCCCGCCATCATCTTAATTCTAATTGCTCTTCCTTCT
ATCGAAATCGTATGAACCATTCTACCAGCCGTCATTTTAGTACTAATCGCCCTGCCCTCC
GTTGAACTAATCTGAACCATCCTACCCGCTATTGTCCTAGTCCTGCTTGCCCTCCCCTCC
ATAGAAACCGTCTGAACTATCCTGCCCGCCATCATCCTAGTCCTCATCGCCCTCCCATCC
ATTGAAATCGTATGAACTGTGCTCCCTGCCCTAATCCTCATTTTAATCGCCCTCCCCTCA
GTTGAAACCATTTGAACTATTCTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCTCT
GTAGAAACAATTTGAACAATTCTCCCAGCTGTCATTCTTATTCTAATTGCCCTTCCCTCC
GTGGAAACGGTGTGAACGATCCTACCCGCTATCATTTTAATTCTCATTGCCCTACCATCA
GTAGAAACTGTCTGAACTATCCTCCCAGCCATTATCTTAATTTTAATTGCCTTGCCTTCA
ATCGAAATAGTGTGAACTATTATACCAGCTATTAGCCTCATCATAATTGCCCTTCCATCC

TTACGAATTCTATACATAATAGATGAAATCAATAACCCATCTCTTACAGTAAAAACCATA
CTACGCATCCTGTACCTTATAGACGAAATTAACGACCCTCACCTGACAATTAAAGCAATA
CTCCAAATCCTCTACATAATAGACGAAATCGACGAACCTGATCTCACCCTAAAAGCCATC
CTACGCATCCTTTACATAACAGACGAGGTCAACGATCCCTCCCTTACCATCAAATCAATT
CTACGAATTCTATATCTTATAGACGAGATTAATGACCCCCACCTAACAATTAAGGCCATG
CTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACCGTTAAAACCATA
CTACGAATTCTATACATAATAGACGAGATTAATAACCCAGTTCTAACAGTAAAAACTATA
TTACGAATCCTCTACATAATGGACGAGATCAATAACCCTTCCTTGACCGTAAAAACTATA
TTACGGATCCTTTACATAATAGACGAAGTCAATAACCCCTCCCTCACTGTAAAAACAATA
CTTCGTATCCTATATTTAATAGATGAAGTTAATGATCCACACTTAACAATTAAAGCAATC

GGACATCAGTGATACTGAAGCTATGAGTATACAGATTATGAGGACTTAAGCTTCGACTCC
GGACACCAATGATACTGAAGTTACGAGTATACAGACTATGAAAATCTAGGATTCGACTCC
GGACACCAATGATACTGAACCTATGAATACACAGACTTCAAGGACCTCTCATTTGACTCC
GGCCACCAATGGTACTGAACCTACGAGTACACCGACTACGGCGGACTAATCTTCAACTCC
GGGCACCAATGATACTGAAGCTACGAGTATACTGATTATGAAAACTTAAGTTTTGACTCC
GGGCACCAATGATACTGAAGCTACGAATATACTGACTATGAAGACCTATGCTTTGATTCA
GGACACCAATGATACTGAAGCTATGAATATACTGACTATGAAGACCTATGCTTTGACTCC
GGACATCAGTGATACTGAAGCTATGAGTACACAGACTACGAAGACCTGAACTTTGACTCA
GGTCACCAATGATATTGAAGCTATGAGTATACCGACTACGAAGACCTAAGCTTCGACTCC
GGCCACCAATGATACTGAAGCTACGAATATACTAACTATGAGGATCTCTCATTTGACTCT

TACATAATTCCAACATCAGAATTAAAGCCAGGGGAGCTACGACTATTAGAAGTCGATAAT
TATATAGTACCAACCCAAGACCTTGCCCCCGGACAATTCCGACTTCTGGAAACAGACCAC
TACATAACCCCAACAACAGACCTCCCCCTAGGCCACTTCCGCCTACTAGAAGTCGACCAT
TACATACTTCCCCCATTATTCCTAGAACCAGGCGACCTGCGACTCCTTGACGTTGACAAT
TACATAATCCCCACCCAGGACCTAACCCCTGGACAATTCCGGCTACTAGAGACAGACCAC
TATATAATCCCAACAAACGACCTAAAACCTGGTGAACTACGACTGCTAGAAGTTGATAAC
TACATAATCCCAACCAATGACCTAAAACCAGGTGAACTTCGTCTATTAGAAGTTGATAAT
TATATGATCCCCACACAAGAACTAAAGCCCGGAGAACTACGACTGCTAGAAGTAGACAAT
TATATAATCCCAACATCAGACCTAAAGCCAGGAGAACTACGATTATTAGAAGTAGATAAC
TATATAATTCCAACTAATGACCTTACCCCTGGACAATTCCGGCTGCTAGAAGTTGATAAT

CGAGTTGTACTACCAATAGAAATAACAATCCGAATGTTAGTCTCCTCTGAAGACGTATTA
CGAATAGTTGTTCCAATAGAATCCCCAGTCCGTGTCCTAGTATCTGCTGAAGACGTGCTA
CGCATTGTAATCCCCATAGAATCCCCCATTCGAGTAATCATCACCGCTGATGACGTCCTC
CGAGTAGTACTCCCGATTGAAGCCCCCATTCGTATAATAATTACATCACAAGACGTCTTG
CGAATGGTTGTTCCCATAGAATCCCCTATTCGCATTCTTGTTTCCGCCGAAGATGTACTA
CGAGTCGTTCTGCCAATAGAACTTCCAATCCGTATATTAATTTCATCTGAAGACGTCCTC
CGGGTAGTCTTACCAATAGAACTTCCAATTCGTATACTAATCTCATCCGAAGACGTCCTG
CGAGTAGTCCTCCCAATAGAAATAACAATCCGCATACTAATCTCATCAGAAGATGTACTC
CGAGTTGTCTTACCTATAGAAATAACAATCCGAATATTAGTCTCATCAGAAGACGTACTC
CGAATAGTAGTCCCAATAGAATCTCCAACCCGACTTTTAGTTACAGCCGAAGACGTCCTC

CACTCATGAGCTGTGCCCTCTCTAGGACTAAAAACAGACGCAATCCCAGGCCGTCTAAAC
CATTCTTGAGCTGTTCCATCCCTTGGCGTAAAAATGGACGCAGTCCCAGGACGACTAAAT
CACTCATGAGCCGTACCCGCCCTCGGGGTAAAAACAGACGCAATCCCTGGACGACTAAAT
CACTCATGAGCTGTCCCCACATTAGGCTTAAAAACAGATGCAATTCCCGGACGTCTAAAC
CACTCCTGGGCCCTTCCAGCCATGGGGGTAAAGATAGACGCGGTCCCAGGACGCCTTAAC
CACTCATGAGCAGTCCCCTCCCTAGGACTTAAAACTGATGCCATCCCAGGCCGACTAAAT
CACTCATGAGCCATCCCTTCACTAGGGTTAAAAACCGACGCAATCCCCGGCCGCCTAAAC
CACTCATGAGCCGTACCGTCCCTAGGACTAAAAACTGATGCTATCCCAGGACGACTAAAC
CACTCATGGGCCGTACCCTCCTTGGGCCTAAAAACAGATGCAATCCCAGGACGCCTAAAC
CACTCGTGAGCTGTACCCTCCTTGGGTGTCAAAACAGATGCAATCCCAGGACGACTTCAT

CAAACAACCCTTATATCGTCCCGTCCAGGCTTATATTACGGTCAATGCTCAGAAATTTGC
CAAGCCGCCTTTATTGCCTCACGCCCAGGGGTCTTTTACGGACAATGCTCTGAAATTTGT
CAAACCTCCTTCATCACCACTCGACCAGGAGTGTTTTACGGACAATGCTCAGAAATCTGC
CAAACCACTTTCACCGCTACACGACCGGGGGTATACTACGGTCAATGCTCTGAAATCTGT
CAAACCGCCTTTATTGCCTCCCGCCCCGGGGTATTCTATGGGCAATGCTCAGAAATCTGT
CAAGCAACAGTAACATCAAACCGACCAGGGTTATTCTATGGCCAATGCTCTGAAATTTGT
CAAGCTACAGTCACATCAAACCGACCAGGTCTATTCTATGGCCAATGCTCTGAAATTTGC
CAAACAACCCTAATAACCATACGACCAGGACTGTACTACGGTCAATGCTCAGAAATCTGT
CAAACAACCTTAATATCAACACGACCAGGCCTATTTTATGGACAATGCTCAGAGATCTGC
CAAACATCATTTATTGCTACTCGTCCGGGAGTATTTTACGGACAATGTTCAGAAATTTGC

GGGTCAAACCACAGTTTCATACCCATTGTCCTTGAGTTAGTCCCACTAAAGTACTTTGAA
GGAGCTAATCACAGCTTTATACCAATTGTAGTTGAAGCAGTACCTCTCGAACACTTCGAA
GGAGCTAACCACAGCTACATACCCATTGTAGTAGAGTCTACCCCCCTAAAACACTTTGAA
GGAGCAAACCACAGTTTCATGCCCATCGTCCTAGAATTAATTCCCCTAAAAATCTTTGAA
GGAGCAAACCACAGCTTTATACCCATCGTAGTAGAAGCGGTCCCACTATCTCACTTCGAA
GGATCTAACCATAGCTTTATGCCCATTGTCCTAGAAATGGTTCCACTAAAATATTTCGAA
GGCTCAAATCACAGCTTCATACCCATTGTACTAGAAATAGTGCCTCTAAAATATTTCGAA
GGTTCAAACCACAGCTTCATACCTATTGTCCTCGAATTGGTCCCACTATCCCACTTCGAG
GGCTCAAACCACAGTTTCATACCAATTGTCCTAGAACTAGTACCCCTAGAAGTCTTTGAA
GGAGCAAACCACAGCTTTATACCAATTGTAGTTGAAGCAGTACCGCTAACCGACTTTGAA

AAATGATCTGCGTCAATATTA---------------------TAA
AACTGATCCTCATTAATACTAGAAGACGCCTCGCTAGGAAGCTAA
GCCTGATCCTCACTA------------------CTGTCATCTTAA
ATA---------------------GGGCCCGTATTTACCCTATAG
AACTGGTCCACCCTTATACTAAAAGACGCCTCACTAGGAAGCTAA
AACTGATCTGCTTCAATAATT---------------------TAA
AACTGATCAGCTTCTATAATT---------------------TAA
AAATGATCTACCTCAATGCTT---------------------TAA
AAATGATCTGTATCAATACTA---------------------TAA
AACTGATCTTCATCAATACTA---GAAGCATCACTA------AGA